Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081L03

Clone ID RBdS081L03
HP ID HP05700
Gene ID 23016
Gene Symbol EXOSC7
Protein Name exosome component 7
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015004.3
Length of RefSeq (bp) 1059
Chromosome 3p21.31
Reference DDBJ accession
UniGene Hs.476092
5'-terminal sequence GGGCTCGTGGGGCAGCTCGGCAGCATGGCGTCCGTGACGCTGAGCGAGGCGGAGAAGGTG
2011.08.28