Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081D24

Clone ID RBdS081D24
HP ID HP09056
Gene ID 80152
Gene Symbol CENPT
Protein Name centromere protein T
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_025082.3
Length of RefSeq (bp) 2360
Chromosome 16q22.1
Reference DDBJ accession
UniGene Hs.288382
5'-terminal sequence GAGCTGGCTGGGCGGTTAGGAGGGCCCGGGGCCGAGACGATGGCTGACCACAACCCTGAC
2011.08.28