Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081C13

Clone ID RBdS081C13
HP ID HP09052
Gene ID 6936
Gene Symbol C2orf3
Protein Name chromosome 2 open reading frame 3
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003203.3
Length of RefSeq (bp) 5185
Chromosome 2p11.2-p11.1
Reference DDBJ accession
UniGene Hs.303808
5'-terminal sequence GACCGGGTTCGGGGCCCTCGTGGCCGGGGCCGGGTCTGGGCGAGCTCCCGGCGTGCCACC
2011.08.28