Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075A06

Clone ID RBdS075A06
HP ID HP09015
Gene ID 1397
Gene Symbol CRIP2
Protein Name cysteine-rich protein 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001312.2
Length of RefSeq (bp) 1236
Chromosome 14q32.3
Reference DDBJ accession
UniGene Hs.534309
5'-terminal sequence GGGGCGGAGGGCGCGGGCCGACCGGGCGCACCGACCATGGCCTCCAAATGCCCCAAGTGC
2011.08.28