Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070F16

Clone ID RBdS070F16
HP ID HP03774
Gene ID 51094
Gene Symbol ADIPOR1
Protein Name adiponectin receptor 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015999.3
Length of RefSeq (bp) 2151
Chromosome 1p36.13-q41
Reference DDBJ accession
UniGene Hs.5298
5'-terminal sequence GGGCCGCAGGCCGCCTCCAGCGCCGCGGGATGTAGCGCGGGGGACCGCGGCCCCCAGCAG
2011.08.28