Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070F04

Clone ID RBdS070F04
HP ID HP09001
Gene ID 56884
Gene Symbol FSTL5
Protein Name follistatin-like 5
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_020116.3
Length of RefSeq (bp) 4867
Chromosome 4q32.3
Reference DDBJ accession
UniGene Hs.591707
5'-terminal sequence GAGTGACTGANACAAACTGGAGGTGAAAGGAGCTGGTACTGTCCACTGTGCTGTCGGTGC
2011.08.28