Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070F02

Clone ID RBdS070F02
HP ID HP09000
Gene ID 55245
Gene Symbol UQCC
Protein Name ubiquinol-cytochrome c reductase complex chaperone
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_018244.3
Length of RefSeq (bp) 2338
Chromosome 20q11.22
Reference DDBJ accession
UniGene Hs.714359
5'-terminal sequence GACCCGGAAATGGTTATTGAGGAACATGGCGTTGCTGGTGCGAGTCCTTAGGAACCAGAC
2011.08.28