Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070E10

Clone ID RBdS070E10
HP ID HP04399
Gene ID 200916
Gene Symbol RPL22L1
Protein Name ribosomal protein L22-like 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001099645.1
Length of RefSeq (bp) 1978
Chromosome 3q26.2
Reference DDBJ accession
UniGene Hs.380933
5'-terminal sequence TGCTCTCTGCTCTCGCGGCCGACTCGCAAGATGGCGCCGCAGAAAGACAGGAAGCCCAAG
2011.08.28