Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051O17

Clone ID RBdS051O17
HP ID HP05754
Gene ID 3156
Gene Symbol HMGCR
Protein Name 3-hydroxy-3-methylglutaryl-Coenzyme A reductase
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000859.2
Length of RefSeq (bp) 4589
Chromosome 5q13.3-q14
Reference DDBJ accession
UniGene Hs.713530
5'-terminal sequence GGCGTNAACTGGAGCCAGGCTGAGCGTCGGCGCCGGGGTTCGGTGGCCTCTAGTGAGATC
2011.08.28