Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051L06

Clone ID RBdS051L06
HP ID HP08987
Gene ID 817
Gene Symbol CAMK2D
Protein Name calcium/calmodulin-dependent protein kinase II delta
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001221.3
Length of RefSeq (bp) 5872
Chromosome 4q26
Reference DDBJ accession
UniGene Hs.144114
5'-terminal sequence GCTTTCTCTCGCCGCGCCGTCTTGAAGCCGCGCGGGCTCGTGAGCAGCGCGAGGCCGCCA
2011.08.28