Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051K01

Clone ID RBdS051K01
HP ID HP08984
Gene ID 171586
Gene Symbol ABHD3
Protein Name abhydrolase domain containing 3
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_138340.4
Length of RefSeq (bp) 2085
Chromosome 18q11.2
Reference DDBJ accession
UniGene Hs.397978
5'-terminal sequence TTGAGACACTGTGGTCGGGAGTAGGCAGCGGCGCCGCGTCCGCTCTCGCCCGCTCTCGCC
2011.08.28