Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051A19

Clone ID RBdS051A19
HP ID HP06598
Gene ID 79019
Gene Symbol CENPM
Protein Name centromere protein M
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_024053.3
Length of RefSeq (bp) 947
Chromosome 22q13.2
Reference DDBJ accession
UniGene Hs.208912
5'-terminal sequence GAGAGAGTGCGGTGCCCACAGGCCTGCAGCGGGTCCAAACCTCAGGCCCCCAGCCCGTGC
2011.08.28