Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040P11

Clone ID RBdS040P11
HP ID HP08970
Gene ID 242
Gene Symbol ALOX12B
Protein Name arachidonate 12-lipoxygenase, 12R type
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001139.2
Length of RefSeq (bp) 2502
Chromosome 17p13.1
Reference DDBJ accession
UniGene Hs.136574
5'-terminal sequence GGCCTGGGCCTGCCCGGCACCCACCCCGGCCACCAAGGGCAGCAGCTTTTCCAGAATTTG
2011.08.28