Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040O16

Clone ID RBdS040O16
HP ID HP05738
Gene ID 285367
Gene Symbol RPUSD3
Protein Name RNA pseudouridylate synthase domain containing 3
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_173659.2
Length of RefSeq (bp) 1218
Chromosome 3p25.3
Reference DDBJ accession
UniGene Hs.33719
5'-terminal sequence GGCTCGGGAGATGGACGGCCGCCGTGTTTTGGGCCGGTTCTGGAGTGGCTGGCGGCGGGG
2011.08.28