Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040N24

Clone ID RBdS040N24
HP ID HP08967
Gene ID 2800
Gene Symbol GOLGA1
Protein Name golgi autoantigen, golgin subfamily a, 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002077.3
Length of RefSeq (bp) 4899
Chromosome 9q33.3
Reference DDBJ accession
UniGene Hs.133469
5'-terminal sequence GNGGCTTCCCAGAGAGAGGCAGGTGCGCGGGCCAGGACTCCGGGAATGCGAGCAGGCCCC
2011.08.28