Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040I04

Clone ID RBdS040I04
HP ID HP05652
Gene ID 54529
Gene Symbol ASNSD1
Protein Name asparagine synthetase domain containing 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_019048.1
Length of RefSeq (bp) 2448
Chromosome 2p24.3-q21.3
Reference DDBJ accession
UniGene Hs.101364
5'-terminal sequence GGTGGCTAATGCCGTAGGCTCCTTCAGGGCTGAGCCATCCCGCGTGTCTTGCGCTCGGTG
2011.08.28