Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040F07

Clone ID RBdS040F07
HP ID HP08955
Gene ID 378708
Gene Symbol APITD1
Protein Name apoptosis-inducing, TAF9-like domain 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_198544.2
Length of RefSeq (bp) 1469
Chromosome 1p36.22
Reference DDBJ accession
UniGene
5'-terminal sequence GGGCGGGAAAATCCGACCTGGCCGCGCACCACCGCCCCTTCTCGGCCCTCCTGCGTTTGC
2011.08.28