Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022H16

Clone ID RBdS022H16
HP ID HP08928
Gene ID 523
Gene Symbol ATP6V1A
Protein Name ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001690.2
Length of RefSeq (bp) 4567
Chromosome 3q13.2-q13.31
Reference DDBJ accession
UniGene Hs.477155
5'-terminal sequence GAGCCTCTGGGTCCTCGGTCGGTACAGTCTCTGCACCTCGCGCCCCAGCAGGTAAACTAA
2011.08.28