Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022D02

Clone ID RBdS022D02
HP ID HP08918
Gene ID 388722
Gene Symbol C1orf53
Protein Name chromosome 1 open reading frame 53
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001024594.1
Length of RefSeq (bp) 588
Chromosome 1q31.3
Reference DDBJ accession
UniGene Hs.61329
5'-terminal sequence GAGCGCCGGGTGCTCCGCCTCCCAAGGCCGGCGGCGGCATGGCGGCCAGGCAGATCTGGG
2011.08.28