Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015I04

Clone ID RBdS015I04
HP ID HP04723
Gene ID 11146
Gene Symbol GLMN
Protein Name glomulin, FKBP associated protein
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_053274.2
Length of RefSeq (bp) 2042
Chromosome 1p22.1
Reference DDBJ accession
UniGene Hs.49105
5'-terminal sequence GGCTAAGACGCCGGAGGAGGTGGCGGCGGCTGGGAGAGGCGAGGGTTCTGGCCGATTTTA
2011.08.28