Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015H19

Clone ID RBdS015H19
HP ID HP08479
Gene ID 85365
Gene Symbol ALG2
Protein Name asparagine-linked glycosylation 2 homolog (S. cerevisiae, alpha-1,3-mannosyltransferase)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_033087.3
Length of RefSeq (bp) 2834
Chromosome 9q22.33
Reference DDBJ accession
UniGene Hs.40919
5'-terminal sequence GGCAGAAGACCCCCATCAGGGTGCGGGGTGCAGTTGCGGCTCCAGGGCCATGGCGGAGGA
2011.08.28