Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015G16

Clone ID RBdS015G16
HP ID HP07766
Gene ID 10978
Gene Symbol CLP1
Protein Name CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006831.2
Length of RefSeq (bp) 1864
Chromosome 11q12
Reference DDBJ accession
UniGene Hs.523687
5'-terminal sequence GACCGCTTGTAGTTTGGTTTAAATTCTGCACGGGAGGACCTTCTGAGTTTACCTGTTGGG
2011.08.28