Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014P10

Clone ID RBdS014P10
HP ID HP01469
Gene ID 1984
Gene Symbol EIF5A
Protein Name eukaryotic translation initiation factor 5A
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001970.3
Length of RefSeq (bp) 1290
Chromosome 17p13-p12
Reference DDBJ accession
UniGene Hs.534314
5'-terminal sequence GAGCGGCGGCGGCGGTAGAGGCGGCGGCGGCGGCGGCAGCGGGCTCGGAGGCAGCGGTTG
2011.08.28