Prev. |  Human A to Z list >  T >  TLCD3B > 

RBdS007M01 - NRCD Human cDNA Clone

Catalog Number HKR403089
Clone Name RBdS007M01
Clone info. Plasmid clone of human FAM57B cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GCTCTTTGCCTCTCCCCATCCCTCGCTGGCCTGCTCCTGCTCCCCTTCTCCCATCCTCCC
Sequence, submitted(3) AB593090 [link]
Note Full cds when compared using AB593090
 
Sequence, refered NM_031478.6 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) TLCD3B (NCBI Gene 83723)  other clone of TLCD3B in our bank
Synonyms CORD22|FAM57B|FP1188
Protein Name TLC domain containing 3B
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR403089 RBdS007M01 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBdS007M01 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR403089).

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2023.07.07

NRCDhumcloneList_RB_2023May03.csv - GNP_filter3_NRCD_html_230707.pl