Prev. |  Human A to Z list >  A >  ABCB10 > 

RBd92D04 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR396876
Clone Name RBd92D04
Clone info. Plasmid clone of human ABCB10 cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GGCGCGCCTGGCCGGCGGGCTGAGGCGTACGGGTCGCACGCAGCGCCATGCGAGGCCCCC
Sequence, submitted(2) n.a.
 
Sequence, refered NM_012089.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) ABCB10 (NCBI Gene 23456)  other clone of ABCB10 in our bank
Synonyms EST20237|M-ABC2|MTABC2
Protein Name ATP binding cassette subfamily B member 10
KEGG hsa:23456
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR396876 RBd92D04 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
RBd92D04a.seq   RBd92D04c.seq   RBd92D04.pdf

References and tips

Featured content

Reference


2018.10.13

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_180123.pl