RBd85A01 - NRCD Human cDNA Clone

Catalog Number HKR394001 Clone Name RBd85A01 Clone info. Plasmid clone of human DSP cDNA with SV40 promoter Vector(1) pGCAP10 5'-terminal sequence(2) TCCTCTGCGCCCTTGCCGCCCTCCGAGCCACAGCTTTCCTCCCGCTCCTGCCCCCGGCCC Sequence, submitted(3) AB621818 [link] Note match NM_001008844.3 (1-7760), CDS:full/var (c.315 A>G, c.2862 C>T)   Sequence, refered NM_004415.2 (NCBI RefSeq mRNA) Gene Symbol and ID(4) DSP (NCBI Gene 1832)  other clone of DSP in our bank Synonyms DCWHKTA|DP Protein Name desmoplakin

Links   KEGG   NCBI Gene   NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

How to cite this biological resource

Materials & Methods section:

Sequence information

Restriction map is not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

References and tips

Featured content

Reference

2023.07.07