Prev. |  Human A to Z list >   >   > 

NRCD Human cDNA Clone - RBd32G02

Ordering information ordering information
Catalog Number HKR372946
Clone Name RBd32G02
Vector plasmidClick for information pGCAP10
Description Plasmid clone of human RARA(upstream, opposite) cDNA with SV40 promoter
5'-terminal sequence(1) GAGAGAAACGCAGGGAACCGAGAGGGAGAGGCGGCATGTGGACAGGCCGGGCCTCATTTG
Sequence, submitted(2) Not available.
 
HP ID HP11093  finder other clones in this HP group.
Sequence, refered BC038432.1
Gene ID
Gene Symbol   finder other clones with this gene.
Protein Name
KEGG link 01
Links

  DDBJ/EMBL/GenBank

Full length sequence and restriction map are not available.

(1) 5' terminal sequence of insert provided by the depositor.

(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips


2017.02.23

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_160109.pl