RBd18G07 - NRCD Human cDNA Clone

Catalog Number HKR367351 Clone Name RBd18G07 Clone info. Plasmid clone of human SEC16A cDNA with SV40 promoter Vector(1) pGCAP10 5'-terminal sequence(2) GGCGAGGAGCGCGCCCGCGTCAGGGCCCCGCGCTTCTCAGCTGGGCGGAGTAGCCGTTCT Sequence, submitted(3) AB593115 [link] Note Full cds when compared using AB593115   Sequence, refered NM_001276418.2 (NCBI RefSeq mRNA) Gene Symbol and ID(4) SEC16A (NCBI Gene 9919)  other clone of SEC16A in our bank Synonyms KIAA0310|SEC16L|p250 Protein Name SEC16 homolog A, endoplasmic reticulum export factor

Links   KEGG   NCBI Gene   NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

How to cite this biological resource

Materials & Methods section:

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

2023.07.07