Prev. |  Human A to Z list >  T >  TRBC1 > 

RBd11G06 - NRCD Human cDNA Clone

Catalog Number HKR364550
Clone Name RBd11G06
Clone info. Plasmid clone of human TRBC1 cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GCAGAGCCATGAATCCAGGCAGAGAAAGGCAGCCATCCTGCTGTCAGGGAGCTAAGACTT
Sequence, submitted(3) n.a.
 
Sequence, refered
Gene Symbol and ID(4) TRBC1 (NCBI Gene 28639)  other clone of TRBC1 in our bank
Synonyms BV05S1J2.2|TCRB|TCRBC1
Protein Name T cell receptor beta constant 1
Links

  KEGG

  NCBI Gene

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR364550 RBd11G06 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBd11G06 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR364550).

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2023.05.03

NRCDhumcloneList_RB_2023Apr25.csv - GNP_filter3_NRCD_html_230424.pl