Prev. |  Human A to Z list >   >   > 

RBd10D04 - NRCD Human cDNA Clone

Catalog Number HKR364076
Clone Name RBd10D04
Clone info. Plasmid clone of human FLT4 cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GGCGCCAAGCGGGACGCCTTCAGCCCCTGCGCGGTGAGCGGGCGGCCTGCGGGGCGCCGC
Sequence, submitted(2) n.a.
Note match to NM_002020.5 (2874-4484) CDS:parcial
 
Sequence, refered NM_002020.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(3)  (NCBI Gene 2324)  other clone of in our bank
Protein Name
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR364076 RBd10D04 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
RBd10D04a.seq   RBd10D04c.seq RBd10D04z.seq RBd10D04.pdf

References and tips

Featured content

Reference


2021.04.21

NRCDhumcloneList_RB_210404.csv - DataSheet_NRCD_html_200831.pl