RBd09G06 - NRCD Human cDNA Clone

Catalog Number HKR363750 Clone Name RBd09G06 Clone info. Plasmid clone of human ATXN1L cDNA with SV40 promoter Vector(1) pGCAP10 5'-terminal sequence(2) ATCTCCGGGCGCCCGGCTGTGGGGGGCGCTGGGTGTGGGGCGGCTCCGGGGCCGGGGATG Sequence, submitted(3) AB621810 [link]   Sequence, refered NM_001137675.2 (NCBI RefSeq mRNA) Gene Symbol and ID(4) ATXN1L (NCBI Gene 342371)  other clone of ATXN1L in our bank Synonyms BOAT|BOAT1 Protein Name ataxin 1 like

Links   KEGG   NCBI Gene   NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

How to cite this biological resource

Materials & Methods section:

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

2023.05.03