Prev. |  Human A to Z list >  A >  ARHGDIG > 

NRCD Human cDNA Clone - RBd09D08

Catalog Number HKR363680
Clone Name RBd09D08
Clone info. Plasmid clone of human ARHGDIG cDNA with SV40 promoter
Vector plasmidClick for information pGCAP10
5'-terminal sequence(1) GGGGGGCGACCCGGGTGCCGGCGCCGTGCGGGCGACACGCGCGTCTCTGCGGGGCTGCGC
Sequence, submitted(2) AB593111 link 01
 
Sequence, refered NM_001176.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) ARHGDIG (NCBI Gene 398) finder other clones with this gene.
Synonyms RHOGDI-3
Protein Name Rho GDP dissociation inhibitor (GDI) gamma
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Ordering Information [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR363680 RBd09D08 DNA solution

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2017.04.06

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_170401.pl