Prev. |  Human A to Z list >  O >  OSGEPL1 > 

RBb67D04 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR346876
Clone Name RBb67D04
Clone info. Plasmid clone of human OSGEPL1 cDNA with SV40 promoter
Vector Click for information pGCAP1
5'-terminal sequence(1) ACTTCCGGGCGCCAGGTTCGGGCTTTCTCCTGCAGCGATAAGGGCAGTCGACAGTCTTTA
Sequence, submitted(2) n.a.
 
Sequence, refered NM_022353.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) OSGEPL1 (NCBI Gene 64172)  other clone of OSGEPL1 in our bank
Synonyms OSGEPL|Qri7
Protein Name O-sialoglycoprotein endopeptidase like 1
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR346876 RBb67D04 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.12.05

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_181121.pl