RBb54E12 - NRCD Human cDNA Clone

Catalog Number HKR341708 Clone Name RBb54E12 Clone info. Plasmid clone of human SFRS4 cDNA with SV40 promoter Vector(1) pGCAP1 5'-terminal sequence(2) TTGGTTGCCGCCGCCGCCGCTGCCGCCGTGCTCTCGCTTTTGCCCGCCGCCGCCTAAGGG Sequence, submitted(3) n.a.   Sequence, refered NM_005626.4 (NCBI RefSeq mRNA) Gene Symbol and ID(4) SRSF4 (NCBI Gene 6429)  other clone of SRSF4 in our bank Synonyms SFRS4|SRP75 Protein Name serine and arginine rich splicing factor 4

Links   KEGG   NCBI Gene   NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

How to cite this biological resource

Materials & Methods section:

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

2023.05.03