NRCD Human cDNA Clone - RBb41F05

Catalog Number HKR336525 Clone Name RBb41F05 Clone info. Plasmid clone of human RPUSD3 cDNA with SV40 promoter Vector Click for information pGCAP1 5'-terminal sequence(1) AAATGTGGGGAGATGGACGGCCGCCGTGTTTTGGGCCGGTTCTGGAGTGGCTGGCGGCGG Sequence, submitted(2) Not available.   Sequence, refered NM_173659.2 (NCBI RefSeq mRNA) Gene Symbol and ID(3) RPUSD3 (NCBI Gene 285367)  other clone of RPUSD3 in our bank Synonyms - Protein Name RNA pseudouridylate synthase domain containing 3 KEGG

Links   NCBI Gene   NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Ordering Information [in Japanese] [in English]

Sequence information

Full length sequence and restriction map are not available.

References and tips

Featured content

Reference

2017.07.03