Prev. |  Human A to Z list >  C >  CADPS > 

NRCD Human cDNA Clone - RBb16A04

Catalog Number HKR326404
Clone Name RBb16A04
Clone info. Plasmid clone of human CADPS cDNA with SV40 promoter
Vector plasmidClick for information pKA1U5
5'-terminal sequence(1) ATCCTGTGTCCTTCAGCAGCCGCAGATGGCATCCGGCTGCGGGCTCGGGGCTCGCAATTG
Sequence, submitted(2) AB593079 link 01
 
Sequence, refered NM_003716.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) CADPS (NCBI Gene 8618) finder other clones with this gene.
Synonyms CADPS1|CAPS|CAPS1
Protein Name Ca++-dependent secretion activator
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Ordering Information [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR326404 RBb16A04 DNA solution

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2017.04.06

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_170401.pl