Prev. |  Human A to Z list >   >   > 

RBb14G07 - NRCD Human cDNA Clone

Catalog Number HKR325751
Clone Name RBb14G07
Clone info. Plasmid clone of human ACE cDNA with SV40 promoter
Vector Click for information pKA1U5
5'-terminal sequence(1) GCTCGACCATGGCCTGGTGAAGAAGCCGGCCAGGCCCNATCAGCCCCATCCCCGCCGCAC
Sequence, submitted(2) n.a.
Note match to NM_000789.4 (1-4962) except some difference.
 
Sequence, refered NM_000789.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3)  (NCBI Gene 1636)  other clone of in our bank
Protein Name
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR325751 RBb14G07 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
RBb14G07a.seq   RBb14G07c.seq RBb14G07z.seq RBb14G07.pdf

References and tips

Featured content

Reference


2021.04.21

NRCDhumcloneList_RB_210404.csv - DataSheet_NRCD_html_200831.pl