Prev. |  Human A to Z list >  A >  AGL > 

NRCD Human cDNA Clone - RBb08E09

Catalog Number HKR323305
Clone Name RBb08E09
Clone info. Plasmid clone of human AGL cDNA with SV40 promoter
Vector plasmidClick for information pKA1U5
5'-terminal sequence(1) ATCCTGGACGGCCAGGTTGGGTACCGGGTGCGCCCAGGAACCCGCGCGAGGCGAAGTCGC
Sequence, submitted(2) AB621804 link 01
 
Sequence, refered NM_000642.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) AGL (NCBI Gene 178) finder other clones with this gene.
Synonyms GDE
Protein Name amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Ordering Information [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR323305 RBb08E09 DNA solution

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2017.04.06

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_170401.pl