Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP11103

HP ID(1) HP11103
Gene ID(2)
Gene Symbol finder TLK2(upstream, opposite)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 17q23.2
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd45C04 pGCAP10 GCTTCTCCAATCAGCGGCCGCGCTGCCGGGCAGGGGTTAACCAGGGGACCCCGCGCCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl