Prev. | NRCD Clone J | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP11102

HP ID(1) HP11102
Gene ID(2)
Gene Symbol finder JUND(exon, antisense)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 19p13.11
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd45A12 pGCAP10 AB593186 GAGCTGGCAGCCGCTGTTGACGTGGCTGAGGACTTTCTGCTTGAGCTGCGCCACCTGCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl