Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP11074

HP ID(1) HP11074
Gene ID(2)
Gene Symbol finder TRIM7 (3'-UTR, antisense)
Protein Name Transcribed locus
RefSeq
Length of RefSeq (bp)
Chromosome 5q35.3
Reference DDBJ accession
UniGene Hs.571028

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi66B05 pGCAP10 AB371541 GAGGATTGGGGAGCACGTTTTGCGTCTTGCTGTGCGTGAGGAAGCGGGGATCCAGGTCAA
ARi66D06 pGCAP10 GGGGCGGGGCGGGGGCCAGGGAAGGGCGTGCGCAGGATTGGGGAGCACGTTTTGCGTCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl