Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP11066

HP ID(1) HP11066
Gene ID(2)
Gene Symbol finder PLEKHA7(exon 2, antisense)
Protein Name Similar to olfactory receptor, family 7, subfamily A, member 17
RefSeq
Length of RefSeq (bp)
Chromosome 11p15.1
Reference DDBJ accession
UniGene Hs.523504

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi44C01 pGCAP10 AB371533 GGACGGGCTCCCCGGTGCGCGGATGCAGCCAGGTCGTGCAGCGGAGCTGGTCACTGCGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl