Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP11050

HP ID(1) HP11050
Gene ID(2)
Gene Symbol finder NUP153(exon 1, antisense)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 6p22.3
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS109F20 pGCAP10 AB371520 CTTTTCCTCAGACCCTCCTGTCTGCTCCACGTGGGGCGCCGGGGCCTCGAACCGCCCGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl