Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP11037

HP ID(1) HP11037
Gene ID(2)
Gene Symbol finder KCTD12(exon1, antisense)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 13q22.3
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd21H06 pGCAP10 AB593182 GGCCCTCCTTGTGCACCCCGCGCCGCGAGGGCGGCGGCCCCGGGCCGGGCTGCTGGGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl