Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP11016

HP ID(1) HP11016
Gene ID(2)
Gene Symbol finder PSG8(intron 2, opposite)
Protein Name Transcribed locus
RefSeq
Length of RefSeq (bp)
Chromosome 19q13.31
Reference DDBJ accession
UniGene Hs.656741

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS013B15 pGCAP10 AB371509 GGCCCACATGATTCCATCACCAAACAATCAGCAGTACTTATTTTTTAGTCCTGTGCTCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl