Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP11009

HP ID(1) HP11009
Gene ID(2)
Gene Symbol finder PGLS(exon1, antisense)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 19p13.11
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi10F11 pGCAP10 AB371507 AGCGCGCTAAGCTAGCTGGCCCGGCAGGGGCGACGGCGGCGGGTAGCTCGCGGGCTAGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl