Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP11002

HP ID(1) HP11002
Gene ID(2)
Gene Symbol finder PI4K2B(upstream)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 4p15.2
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd01G12 pGCAP10 GACACACAAACTTCAGGAAAGGATTTTGCACTTGTGCAGACCGGGCGAGCAGAGTAAGAA
RBdS110A01 pGCAP10 GACTTGTGCAGACCGGGCGAGCAGAGTAAGAAGCAGGTCCCGCATACCAACAAAACTAAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl