Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10987

HP ID(1) HP10987
Gene ID(2)
Gene Symbol finder PSG8(intron, opposite)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 19q13.2-q13.31
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe70C02 pKA1U5 AB371496 ATCCTGGCCCTTTGCGTCAGATCCCTGTGGGCAAGCTGCTACCAGGTGAAAAGCTTGGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl