Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10982

HP ID(1) HP10982
Gene ID(2)
Gene Symbol finder PHF13(upstream, opposite)
Protein Name no EST
RefSeq
Length of RefSeq (bp)
Chromosome 1p36.31
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh05B05 pGCAP1 GGTTTTCGCGGCTGCGGGCTTCGTGCGGCTCCCTGCTCCGGGCCCGCGGGGCCGGGACTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl