Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10876

HP ID(1) HP10876
Gene ID(2)
Gene Symbol finder PSG6(downstream)
Protein Name no EST
RefSeq
Length of RefSeq (bp)
Chromosome 19q13.31
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe36D04 pKA1U5 AB371480 GACCCCCACTCTCACTAAACTTAATAATAAATGCTGGTGTATCCAGTGCATTGGCAGCAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl